Lexikon: Telomer

 

A B C D E F G H I J K L M N O P Q R S T U V W X Y Z   Alle

Die Telomere sind die natürlichen einsträngigen Chromosomenenden linearer en. Sie sind für die Stabilität von Chromosomen wesentliche Strukturelemente der Desoxyribonukleinsäure|DNA, die einen hohen Guanin- und Thymin-Anteil besitzen und eine hochrepetitive DNA-Sequenz|Sequenz darstellen. Bei allen n findet man z.B. die 6 Nukleotide TTAGGG in bis zu 20 kbp langen Wiederholungen. Für den Stabilisierungseffekt ist auch die gefaltete Sekundärstruktur der Telomere wichtig.

Die Bedeutung der Chromosomenenden für deren Stabilität erkannten erstmals die amerikanischen Nobelpreisträger Barbara McClintock und Hermann Joseph Muller, die auch den Begriff Telomer (griechisch: End-Teil) prägten. Telomere werden mit biologischen Vorgängen in Verbindung gebracht, die mit der Alterung von Zellen (Zellseneszenz), aber auch deren Immortalisierung (und damit auch Entstehung von Krebs (Medizin)|Krebs) zusammenhängen.

Mit jeder werden die Telomere verkürzt; unterschreitet die Telomerlänge ein kritisches Minimum um die 4 kbp, tritt normalerweise der Zelltod ein. Das Telomerase (ein --Komplex, genauer: eine reverse Transkriptase) macht die Verkürzung der Telomere rückgängig, in dem es nach jeder Zellteilung das fehlende Stück wieder ergänzt. Zellen in denen dieses Enzym aktiv ist können sich sehr viel häufiger teilen als andere Körperzellen. Aktiv ist die Telomerase prinzipiell bei einzelligen (Protozoen), bei höheren Mehrzeller|mehrzelligen Organismen jedoch nur in ganz bestimmten Zellen:

  • in den Zellen der Keimbahn (siehe auch Keimzellen),
  • in Zellen, die sich sehr häufig teilen müssen, wie den embryonale Stammzellen (z.B. Knochenmarkstammzellen) oder den Leukozyten|Immunzellen, sowie
  • in bis zu 80% aller proliferierender Krebs (Medizin)|Krebszellen.

Die Enzymaktivität der Telomerase läßt sich durch die TRAP|TRAP-Methode feststellen.

Eine größere Länge der Telomere und damit eine erhöhte Stressresistenz der Zellen hat mit aller Wahrscheinlichkeit einen bedeutenden Einfluss auf die Gesamtlebenserwartung eines Organismus. Dies wurde zuletzt durch eine Studie koreanischer Wissenschaftler mit dem Fadenwurm Caenorhabditis elegans bestätigt: Dem Wurm wurden längere Chromosomenenden "angezüchtet", was die durchschnittliche Lebensdauer von 20 auf 34 Tage verlängerte (Long lifespan in worms with long telomeric DNA in Nature Genetics 36 (2004) 607-611).

Eine weitere Studie aus dem Jahr 2004 mit 58 Frauen, die an der Universität von Kalifornien in San Francisco durchgeführt wurde, erhärtet den Befund, dass Telomere maßgeblich an der immer wieder beobachteten Wirkung von auf und Seneszenz|Alterungsprozesse beteiligt sind. Die Wissenschaftler konnten zeigen, dass Stress nicht nur die Bildung aggressiver freie Radikale|freier Radikale fördert, sondern auch die Aktivität der Telomerase negativ beeinflusst und damit wiederum auch die Länge der Telomere. Je höher das Stressniveau war, dem die Studienteilnehmerinnen im Alltag ausgesetzt waren und je länger diese Belastung andauerte, desto kürzer waren auch die Telomere, d.h. desto älter waren damit biologisch betrachtet deren Zellen. Bei Probandinnen die über den meisten Stress im Alltag klagten, waren die Telomere so stark verkürzt, dass sie etwa denen von zehn Jahre älteren Frauen mit wenig Stress entsprachen. Da die Länge der Telomere ein Indikator für das Alter von Zellen ist und Stress nach den Ergebnissen dieser Studie die Telomerlängen verkürzt, lässt sich folgern, dass Stress Zellen schneller altern lässt. Die Forscher vermuten, dass diese beschleunigte Zellalterung eine Ursache dafür ist, warum Menschen mit Stress anfälliger sind für Erkrankungen z.B. des Herz-Kreislaufsystems oder auch des s.


Beispiele für Sequenzen von Telomeren bei verschiedenen Organismen
Gruppe (Reich, Stamm) Organismus Telomerische Wiederholungseinheit (5' to 3' zu Richtung Ende)
, Maus, Xenopus TTAGGG
Filamentöse (Fungi) Neurospora crassa TTAGGG
Schleimpilze Physarum, Didymium
Dictyostelium
TTAGGG
AG(1-8)
Kinetoplastiden (Protozoa) Trypanosoma, Crithidia TTAGGG
Ciliata (Wimpertierchen, Protozoa) Glaucoma
Paramecium
Oxytricha, Stylonychia, Euplotes
TTGGGG
TTGGG(T/G)
TTTTGGGG
Apicomplexa (Plasmodium, Protozoa) TTAGGG(T/C)
Höhere Pflanzen Arabidopsis thaliana TTTAGGG
Chlamydomonas TTTTAGGG
Bombyx mori TTAGG
Schlauchwürmer Ascaris lumbricoides TTAGGC
Spalt-Hefen (Schizosaccharomyces) Schizosaccharomyces pombe TTAC(A)(C)G(1-8)
Knospungs-Hefen Saccharomyces cerevisiae

Candida glabrata
Candida albicans
Candida tropicalis
Candida maltosa
Candida guillermondii
Candida pseudotropicalis
Kluyveromyces lactis

TGTGGGTGTGGTG (vom RNA-Template)

or G(2-3)(TG)(1-6)T (Konsensus)
GGGGTCTGGGTGCTG
GGTGTACGGATGTCTAACTTCTT
GGTGTAC/AGGATGTCACGATCATT
GGTGTACGGATGCAGACTCGCTT
GGTGTAC
GGTGTACGGATTTGATTAGTTATGT
GGTGTACGGATTTGATTAGGTATGT


Literatur

  • B. McClintock (1941), The stability of broken ends of chromosomes in Zea mays, Genetics 26: 234-282
  • H. J. Müller (1938), The remaking of chromosomes, The Collecting Net-Woods Hole 13: 181-198
  • Online-Vorabveröffentlichung, DOI: 10.1073/pnas.0407162101, Autor: Elissa Epel et al., 2004


en:Telomere es:Telómero fi:Telomeeri fr:Télomère ja:テロメア


Kategorie:Zellbiologie